View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15747_low_6 (Length: 262)

Name: NF15747_low_6
Description: NF15747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15747_low_6
NF15747_low_6
[»] chr7 (2 HSPs)
chr7 (20-248)||(40651056-40651289)
chr7 (5-83)||(40650381-40650459)


Alignment Details
Target: chr7 (Bit Score: 184; Significance: 1e-99; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 20 - 248
Target Start/End: Original strand, 40651056 - 40651289
Alignment:
Q  20 cgaaaacggtagatttgtttttatagggggtgaaaaacaaaattcgttaattttatgaggacgaccttatttctaaaaatgagcaacgatatcttaagga 119  Q
    ||||||||||||||||||||||||||||| |||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
T  40651056 cgaaaacggtagatttgtttttatagggg-tgaaaaacaaaattggttaattttacgaggacgaccttatttctaaaaatgagcaacgatatcttaagga 40651154  T
Q  120 ggaaggtagaggaatggggttgttttgacatgttgacacgctc------gaaatagaaataaaataaaagatagtactaattaattttcgacacactgac 213  Q
    ||||||||||||||||||||||||||||||||||||| |||||      ||||||||||||||||||||||||||| ||||||||||||||||||| |||    
T  40651155 ggaaggtagaggaatggggttgttttgacatgttgacgcgctcgaaatagaaatagaaataaaataaaagatagtaataattaattttcgacacaccgac 40651254  T
Q  214 atctcttttcaccgaaatttctcatatctctctct 248  Q
    |||||||||||||||||||||||||||||||||||    
T  40651255 atctcttttcaccgaaatttctcatatctctctct 40651289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 5 - 83
Target Start/End: Complemental strand, 40650459 - 40650381
Alignment:
Q  5 aaaaattaagtagag-cgaaaacggtagatttgtttttatagggggtgaaaaacaaaattcgttaattttatgaggacga 83  Q
    ||||||||||||| | |||||||| | ||||| ||||||||||||  ||||| ||||||||| |||||||||||||||||    
T  40650459 aaaaattaagtagggacgaaaacgatggatttttttttataggggc-gaaaatcaaaattcgctaattttatgaggacga 40650381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University