View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15745_low_90 (Length: 258)

Name: NF15745_low_90
Description: NF15745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15745_low_90
NF15745_low_90
[»] chr6 (3 HSPs)
chr6 (85-212)||(31094037-31094164)
chr6 (138-242)||(31051191-31051294)
chr6 (85-119)||(31051163-31051197)
[»] scaffold0202 (1 HSPs)
scaffold0202 (85-237)||(2709-2867)
[»] scaffold0018 (1 HSPs)
scaffold0018 (121-191)||(173390-173460)


Alignment Details
Target: chr6 (Bit Score: 104; Significance: 6e-52; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 85 - 212
Target Start/End: Complemental strand, 31094164 - 31094037
Alignment:
Q  85 ctgaatttattgttaccaatattagttgcatttaggtattatcatcattgttacatttagataacaaacttgtggagttgtttgaaatgttcaaattcaa 184  Q
    ||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  31094164 ctgaatttattgttaccaatattagttgcatttagatattaacatcattgttacatttagataacaaacttgtggagttgtttgaaatgttcaaattcaa 31094065  T
Q  185 ttcagattgttgcaaacaattgcctcaa 212  Q
    |||||||  |||||||||  ||||||||    
T  31094064 ttcagatatttgcaaacacatgcctcaa 31094037  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 138 - 242
Target Start/End: Original strand, 31051191 - 31051294
Alignment:
Q  138 catttagataacaaacttgtggagttgtttgaaatgttcaaattcaattcagattgttgcaaacaattgcctcaagaaaacaaacatggaagcaatagta 237  Q
    |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||| || |||||||||||||||||||||    
T  31051191 catttagataacaaacttgtggagttatttgaaatgttcaaattcaattcagattgttgcaaacaaatgcctcaa-aagacaaacatggaagcaatagta 31051289  T
Q  238 gtaag 242  Q
    |||||    
T  31051290 gtaag 31051294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 85 - 119
Target Start/End: Original strand, 31051163 - 31051197
Alignment:
Q  85 ctgaatttattgttaccaatattagttgcatttag 119  Q
    |||||||||||||||| ||||||||||||||||||    
T  31051163 ctgaatttattgttacaaatattagttgcatttag 31051197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0202 (Bit Score: 92; Significance: 9e-45; HSPs: 1)
Name: scaffold0202
Description:

Target: scaffold0202; HSP #1
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 85 - 237
Target Start/End: Complemental strand, 2867 - 2709
Alignment:
Q  85 ctgaatttattgttaccaatattagttgcatttaggtattatcatcattgttacattta------gataacaaacttgtggagttgtttgaaatgttcaa 178  Q
    ||||||||||||||||| | ||||||||||||||| ||||| |||||||||||||||||      |||||||||||||||||||| || |||||||||||    
T  2867 ctgaatttattgttaccgacattagttgcatttagatattaacatcattgttacatttacatttagataacaaacttgtggagttcttcgaaatgttcaa 2768  T
Q  179 attcaattcagattgttgcaaacaattgcctcaagaaaacaaacatggaagcaatagta 237  Q
    ||||||||||||||||||||| ||  ||||||||||| ||||||||||||| |||||||    
T  2767 attcaattcagattgttgcaagcacatgcctcaagaagacaaacatggaagtaatagta 2709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0018 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: scaffold0018
Description:

Target: scaffold0018; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 121 - 191
Target Start/End: Complemental strand, 173460 - 173390
Alignment:
Q  121 tattatcatcattgttacatttagataacaaacttgtggagttgtttgaaatgttcaaattcaattcagat 191  Q
    ||||| ||||||||||||||| ||||||||||||||| ||||| |||||||||||||||||||||||||||    
T  173460 tattaacatcattgttacattcagataacaaacttgtcgagttatttgaaatgttcaaattcaattcagat 173390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University