View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15745_low_132 (Length: 215)

Name: NF15745_low_132
Description: NF15745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15745_low_132
NF15745_low_132
[»] chr4 (1 HSPs)
chr4 (18-202)||(32259244-32259428)
[»] chr8 (3 HSPs)
chr8 (28-104)||(2431737-2431813)
chr8 (28-101)||(2435130-2435203)
chr8 (18-74)||(2517304-2517360)


Alignment Details
Target: chr4 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 18 - 202
Target Start/End: Complemental strand, 32259428 - 32259244
Alignment:
Q  18 ctcttgactaccagcacttccaacaacataacaacccaacaattttgcaaattgtccggccagctgaccgacagcacctgatgccgccgagatgaagacg 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
T  32259428 ctcttgactaccagcacttccaacaacataacaacccaacaattttgcaaattgtccggccagctgaccgacagcacctgatgccgccgagatgaagaca 32259329  T
Q  118 ctttctcctttctttagagaaccaacttcaaagattccggcatatgcagtaataccaggcatgcctattggattagaaagaataa 202  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  32259328 ctttctcctttctttagagaaccaacttcaaagattccggcatatgcagtaataccaggcatgcctattggattagaaagaataa 32259244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 33; Significance: 0.000000001; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 28 - 104
Target Start/End: Complemental strand, 2431813 - 2431737
Alignment:
Q  28 ccagcacttccaacaacataacaacccaacaattttgcaaattgtccggccagctgaccgacagcacctgatgccgc 104  Q
    ||||||||||||||||||||||||||   ||||||||||||||| ||  | || ||||| |||||||  ||||||||    
T  2431813 ccagcacttccaacaacataacaaccatgcaattttgcaaattggccaacaagttgaccaacagcactggatgccgc 2431737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 28 - 101
Target Start/End: Complemental strand, 2435203 - 2435130
Alignment:
Q  28 ccagcacttccaacaacataacaacccaacaattttgcaaattgtccggccagctgaccgacagcacctgatgc 101  Q
    ||||||||||||||||||||||||||   || |||||||||||| ||  | || ||||| |||||||| |||||    
T  2435203 ccagcacttccaacaacataacaaccatgcagttttgcaaattgacctacaagttgaccaacagcaccggatgc 2435130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 18 - 74
Target Start/End: Original strand, 2517304 - 2517360
Alignment:
Q  18 ctcttgactaccagcacttccaacaacataacaacccaacaattttgcaaattgtcc 74  Q
    ||||| ||| |||||||||||||||||||| |||||   |||||| |||||||||||    
T  2517304 ctctttacttccagcacttccaacaacatagcaaccatgcaatttagcaaattgtcc 2517360  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University