View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15745_low_100 (Length: 250)

Name: NF15745_low_100
Description: NF15745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15745_low_100
NF15745_low_100
[»] chr1 (2 HSPs)
chr1 (15-250)||(31322691-31322926)
chr1 (134-194)||(42563705-42563765)


Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-99; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 15 - 250
Target Start/End: Complemental strand, 31322926 - 31322691
Alignment:
Q  15 tatactaatcaaagtagaaatagaccagttcttttataagcttcaaattcaaataattgtaaacggtttatactcttaagtagttatcgaagatatattt 114  Q
    ||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  31322926 tatactaatcaaagtagaaatagaccagttcttttataagctttatattcaaataattgtaaacggtttatactcttaagtagttatcgaagatatattt 31322827  T
Q  115 caacatataagttttttcattttgttattatgttactgatacaaagttttcaccgtcgtttaccagtgattaatcttcattggaaaatcggtgaggtaca 214  Q
    ||||||||||||| ||||||||||||| ||||||| || |||||||||||||| ||||||||||||| | |||||||||||||||||||||||||||| |    
T  31322826 caacatataagttgtttcattttgttactatgttattggtacaaagttttcactgtcgtttaccagtaactaatcttcattggaaaatcggtgaggtata 31322727  T
Q  215 taaggtggattttctcctttcaatcgagttttctcc 250  Q
    |||||||| || || |||||||||||||||||||||    
T  31322726 taaggtgggttctcccctttcaatcgagttttctcc 31322691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 134 - 194
Target Start/End: Original strand, 42563705 - 42563765
Alignment:
Q  134 ttttgttattatgttactgatacaaagttttcaccgtcgtttaccagtgattaatcttcat 194  Q
    |||| ||| |||| || |||||||||||||| ||| ||||||| |||||||||||||||||    
T  42563705 tttttttactatgatattgatacaaagtttttaccctcgtttaacagtgattaatcttcat 42563765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University