View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15745_high_49 (Length: 355)

Name: NF15745_high_49
Description: NF15745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15745_high_49
NF15745_high_49
[»] chr2 (1 HSPs)
chr2 (231-337)||(11112193-11112299)


Alignment Details
Target: chr2 (Bit Score: 99; Significance: 8e-49; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 99; E-Value: 8e-49
Query Start/End: Original strand, 231 - 337
Target Start/End: Original strand, 11112193 - 11112299
Alignment:
Q  231 tagtaacttctaaaagccaacaagttgagaagcaaaatcaaaataccctagtccataaaatgaaaatttcacgaaggtagtgacaaacctgatattaaat 330  Q
    ||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
T  11112193 tagtaacttctaaaaaccaacaagttgagaagcaaaatcaaaataccctaatccataaaatgaaaatttcacgaaggtagtgacaaacctgatattaaat 11112292  T
Q  331 aaccttg 337  Q
    |||||||    
T  11112293 aaccttg 11112299  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University