View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15738_high_9 (Length: 232)

Name: NF15738_high_9
Description: NF15738
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15738_high_9
NF15738_high_9
[»] chr6 (1 HSPs)
chr6 (85-232)||(21913771-21913914)


Alignment Details
Target: chr6 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 85 - 232
Target Start/End: Original strand, 21913771 - 21913914
Alignment:
Q  85 cacgttaacaacttgacataagtcattacatcacatctgaaatttagcacagtcttcaaaacaaacactgtcactctctattgattgattattcttcata 184  Q
    ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    |||||||||||||||||    
T  21913771 cacgttaacaacttgacataagttattacatcacatctgaaatttagcacagtcttcaaaacaaacactgtcactctct----attgattattcttcata 21913866  T
Q  185 nnnnnnnnccaccatgaccgatttccaccaccaccaccaacaccgccc 232  Q
            ||||||||||||||||||||||||||||||||||||||||    
T  21913867 ttttttttccaccatgaccgatttccaccaccaccaccaacaccgccc 21913914  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University