View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15736_high_15 (Length: 286)

Name: NF15736_high_15
Description: NF15736
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15736_high_15
NF15736_high_15
[»] chr5 (1 HSPs)
chr5 (15-268)||(28309793-28310046)


Alignment Details
Target: chr5 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 15 - 268
Target Start/End: Complemental strand, 28310046 - 28309793
Alignment:
Q  15 atgaagatacttgcaaagaatgaaaagttcgagaaaatcgtgagtcccacaatttggtttttgcaacatgtgtttacaagggaggaggagaatattgcta 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  28310046 atgaagatacttgcaaagaatgaaaagttcgagaaaatcgtgagtcccacaatttggtttttgcaacatgtgtttacaagggaggaggagaatattgcta 28309947  T
Q  115 gtgaaaatgctagcagtgttgttgtggccacaagagacaggctgagcttcagcatccacccagccgtagccactatgataggagccgaggaagacggagg 214  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||| |||||||||||| ||||||||||||||||||| |||||    
T  28309946 gtgaaaatgctagcagtgttgttgtggccataagagacaggctgagcttcaacatccacccggccgtagccactgtgataggagccgaggaagaaggagg 28309847  T
Q  215 aagggagccaccgtgaggagcagacattgtttgagaagaggaagatgaagattc 268  Q
    ||||||||||  |||||||| |||||||||||||||||||||||||||||||||    
T  28309846 aagggagccatggtgaggagtagacattgtttgagaagaggaagatgaagattc 28309793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University