View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15735_low_69 (Length: 253)

Name: NF15735_low_69
Description: NF15735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15735_low_69
NF15735_low_69
[»] chr3 (2 HSPs)
chr3 (1-132)||(50504461-50504594)
chr3 (128-218)||(50504324-50504414)


Alignment Details
Target: chr3 (Bit Score: 109; Significance: 6e-55; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 1 - 132
Target Start/End: Complemental strand, 50504594 - 50504461
Alignment:
Q  1 gtgttaacgggcacaagatggcacatggtggtgg---ccattgcatcagctgaattggaccagatgtcagagctggggggttaactatatattgacattg 97  Q
    |||||||| |||||||||||||||||||||||||   |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  50504594 gtgttaactggcacaagatggcacatggtggtggtggccattgcatcagctgaattggaccagatgtcagagctggggggttaactatatattgacattg 50504495  T
Q  98 atgtattagtaacccccacaaccacctaaaccttc 132  Q
    |||||||||||| ||||||||||||||||||||||    
T  50504494 atgtattagtaa-ccccacaaccacctaaaccttc 50504461  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 128 - 218
Target Start/End: Complemental strand, 50504414 - 50504324
Alignment:
Q  128 ccttcatttactttcgtagattattaatttattaggctggcctgatactgaataccataatcaactttaaaactcttgcgaatgtgttagt 218  Q
    ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
T  50504414 ccttcatttactttcgtagattattaatttattaggctggcctgaaactgaataccataatcaactttaaaactcttgcgaatgtgttagt 50504324  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University