View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15735_low_58 (Length: 292)

Name: NF15735_low_58
Description: NF15735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15735_low_58
NF15735_low_58
[»] chr8 (1 HSPs)
chr8 (18-282)||(26459043-26459308)


Alignment Details
Target: chr8 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 18 - 282
Target Start/End: Original strand, 26459043 - 26459308
Alignment:
Q  18 taaatgatactatttgatagcagcactggcttaatcagtttcataagaattaaccttgcttgcaagttaatgttaagggcattcttgttgattgattatt 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
T  26459043 taaatgatactatttgatagcagcactggcttaatcagtttcataagaattcaccttgcttgcaagttaatgttaagggcattcttgttgattgattatt 26459142  T
Q  118 gatatgtcaggtctgtgcaagtttttattggctacttacacgtttat-ggttatgacttcatggggtacttgtttgtttcaagagaaagaactggtttta 216  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  26459143 gatatgtcaggtctgtgcaagtttttattggctacttacacgtttatgggttatgacttcatggggtacttgtttgtttcaagagaaagaactggtttta 26459242  T
Q  217 ttttatgtctcttctttattttgttgttaacacaagcaagtaaaaatgcattatcttatttctgtg 282  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  26459243 ttttatgtctcttctttattttgttgttaacacaagcaagtaaaaatgcattatcttatttctgtg 26459308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University