View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15731_low_7 (Length: 339)

Name: NF15731_low_7
Description: NF15731
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15731_low_7
NF15731_low_7
[»] chr4 (1 HSPs)
chr4 (18-330)||(9499733-9500044)


Alignment Details
Target: chr4 (Bit Score: 293; Significance: 1e-164; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 293; E-Value: 1e-164
Query Start/End: Original strand, 18 - 330
Target Start/End: Original strand, 9499733 - 9500044
Alignment:
Q  18 ccacctatggtgtcctatcatttttgtggatcccccactcctctaagggtttgaaccaaagcctctcccatcaccaacccccactttttatgaaggcctt 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  9499733 ccacctatggtgtcctatcatttttgtggatcccccactcctctaagggtttgaaccaaagcctctcccatcaccaacccccactttttatgaaggcctt 9499832  T
Q  118 attccactccaccatttgttgcctactttcaatttctgtacatggtttgttattgtctgctagaatattatggcgtcgtttgatccacttagtgggataa 217  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||    
T  9499833 attccactccaccatttgttgcctactttcaatttctgtacatggtctgttattgtctgctagaatattatggcgtcgtttgatccactcagtgggataa 9499932  T
Q  218 ggctaggttgttgtttattactgtttgctgaccgttctggtatgttgctggccatccctcccactgttcttttttcacatgtcagtgagctttgttctgt 317  Q
    |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
T  9499933 ggctaggttgttgtttattactgtctgctgaccgttctggtatgttgctggccatccctcccactgttcttttttcacatgtcagtgagctttgttctg- 9500031  T
Q  318 ttttgcataactt 330  Q
    |||||||||||||    
T  9500032 ttttgcataactt 9500044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University