View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15731_low_14 (Length: 241)

Name: NF15731_low_14
Description: NF15731
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15731_low_14
NF15731_low_14
[»] chr8 (1 HSPs)
chr8 (9-144)||(43289228-43289359)


Alignment Details
Target: chr8 (Bit Score: 111; Significance: 4e-56; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 9 - 144
Target Start/End: Original strand, 43289228 - 43289359
Alignment:
Q  9 gaaatgaatgaggaagaagacacaagtaattaaactcaaagatgcaataaacaagacagatagataataaacacgatagagacaagaaatgtatttagcc 108  Q
    |||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||    |||||||||||||||||||||||||||||||||||    
T  43289228 gaaatggatgaggaagaagacacaggtaattaaactcaaagatgcaataaacaagacagat----aataaacacgatagagacaagaaatgtatttagcc 43289323  T
Q  109 cttgaagtgaaaaaattgctaaaggaccctcacaca 144  Q
    ||||||||||||||||||||||||||||||||||||    
T  43289324 cttgaagtgaaaaaattgctaaaggaccctcacaca 43289359  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University