View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1572_low_6 (Length: 239)

Name: NF1572_low_6
Description: NF1572
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1572_low_6
NF1572_low_6
[»] chr4 (2 HSPs)
chr4 (97-221)||(7153219-7153342)
chr4 (1-49)||(7153343-7153391)


Alignment Details
Target: chr4 (Bit Score: 101; Significance: 3e-50; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 97 - 221
Target Start/End: Complemental strand, 7153342 - 7153219
Alignment:
Q  97 tatatatctctagataacttaacaagtttccaaagatgaatcttccacaaagcctatttatcatatgataaattcgtttcatacaaaagacaaaaaggta 196  Q
    |||||||||||||||| |||||||||||||||| ||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||    
T  7153342 tatatatctctagatagcttaacaagtttccaa-gatgaatcttctacaaagtctatttatcatatgataaattcgtttcatacaaaagacaaaaaggta 7153244  T
Q  197 aggtaaataggaacccctagtcaaa 221  Q
    |||||||||||| ||||||||||||    
T  7153243 aggtaaataggatcccctagtcaaa 7153219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 7153391 - 7153343
Alignment:
Q  1 atttatccaagaaatagaatgtatattgtgagactcatgagtatccaac 49  Q
    |||||||||||||||||||||||| ||||||||||||||||||||||||    
T  7153391 atttatccaagaaatagaatgtatcttgtgagactcatgagtatccaac 7153343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University