View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15729_low_4 (Length: 421)

Name: NF15729_low_4
Description: NF15729
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15729_low_4
NF15729_low_4
[»] chr2 (1 HSPs)
chr2 (307-421)||(2693992-2694108)


Alignment Details
Target: chr2 (Bit Score: 73; Significance: 3e-33; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 307 - 421
Target Start/End: Complemental strand, 2694108 - 2693992
Alignment:
Q  307 atgctctgtgttttagtttgctaagcggggtttctnnnnnnnt--gcgcactacaatgcatattatttggttagcatctgggtaaattggagtgaacaaa 404  Q
    |||||| |||| |||||||||||||||||||||||       |  |||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
T  2694108 atgctccgtgtattagtttgctaagcggggtttctaaaaaaatatgcgcactacaatgcatattatttggttagcatctgggtaatttggagtgaacaaa 2694009  T
Q  405 atcaccgtaggtcaaaa 421  Q
    |||||||||||||||||    
T  2694008 atcaccgtaggtcaaaa 2693992  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University