View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15725_low_9 (Length: 311)

Name: NF15725_low_9
Description: NF15725
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15725_low_9
NF15725_low_9
[»] chr8 (1 HSPs)
chr8 (156-290)||(40577659-40577793)
[»] chr4 (1 HSPs)
chr4 (187-227)||(734268-734308)
[»] chr3 (1 HSPs)
chr3 (187-227)||(45390661-45390701)


Alignment Details
Target: chr8 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 156 - 290
Target Start/End: Complemental strand, 40577793 - 40577659
Alignment:
Q  156 ggtgcagcctaaggttatcatagtgattctgaaagttcacatgcattgtgaagcttgttcacaagaaatcaagagacgcattgagaaaatcaaaggtatg 255  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  40577793 ggtgcagcctaaggttatcatagtgattctgaaagttcacatgcattgtgaagcttgttcacaagaaatcaagagacgcattgagaaaatcaaaggtatg 40577694  T
Q  256 ttactgtgttctgttttgattgaaattcagatttt 290  Q
    |||||||||||||||||||||||||||||||||||    
T  40577693 ttactgtgttctgttttgattgaaattcagatttt 40577659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 187 - 227
Target Start/End: Complemental strand, 734308 - 734268
Alignment:
Q  187 aaagttcacatgcattgtgaagcttgttcacaagaaatcaa 227  Q
    ||||||||||||||||||||||||||| || | ||||||||    
T  734308 aaagttcacatgcattgtgaagcttgtgcagaggaaatcaa 734268  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 187 - 227
Target Start/End: Complemental strand, 45390701 - 45390661
Alignment:
Q  187 aaagttcacatgcattgtgaagcttgttcacaagaaatcaa 227  Q
    ||||||||||||||||||||||||||| || | ||||||||    
T  45390701 aaagttcacatgcattgtgaagcttgtgcagaggaaatcaa 45390661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University