View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15725_low_23 (Length: 229)

Name: NF15725_low_23
Description: NF15725
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15725_low_23
NF15725_low_23
[»] chr1 (2 HSPs)
chr1 (13-93)||(27446524-27446606)
chr1 (141-210)||(27446768-27446837)


Alignment Details
Target: chr1 (Bit Score: 72; Significance: 7e-33; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 13 - 93
Target Start/End: Original strand, 27446524 - 27446606
Alignment:
Q  13 gagatgaactaggatacgttattctcatcatcttaattgctcactaaaagaatattaca--tttgtttaaagagaatctaata 93  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||    
T  27446524 gagatgaactaggatacgttattctcatcatcttaattgctcactaaaagaatattacatttttgtttaaagagaatctaata 27446606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 141 - 210
Target Start/End: Original strand, 27446768 - 27446837
Alignment:
Q  141 tatgtaatatagtttcttttttacaaactggggcaaatgcaatgtatttcacaggccagttggaatcatc 210  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  27446768 tatgtaatatagtttcttttttacaaactggggcaaatgcaatgtatttcacaggccagttggaatcatc 27446837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University