View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15724_high_6 (Length: 326)

Name: NF15724_high_6
Description: NF15724
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15724_high_6
NF15724_high_6
[»] scaffold0356 (1 HSPs)
scaffold0356 (11-324)||(11261-11574)
[»] chr8 (1 HSPs)
chr8 (14-324)||(19739578-19739888)
[»] scaffold0075 (1 HSPs)
scaffold0075 (171-241)||(48730-48800)
[»] chr6 (1 HSPs)
chr6 (170-228)||(15144206-15144264)
[»] chr4 (1 HSPs)
chr4 (171-241)||(9007-9077)
[»] chr1 (1 HSPs)
chr1 (203-235)||(8636213-8636245)


Alignment Details
Target: scaffold0356 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: scaffold0356
Description:

Target: scaffold0356; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 11 - 324
Target Start/End: Original strand, 11261 - 11574
Alignment:
Q  11 gcaaaggcattcgatgcgttagattggaattttcttcttgcggtgcttcagcggtttagttttgatgaaaaatttgtgcattggattttggtgattttgc 110  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
T  11261 gcaaaggcattcgatacgttagattggaattttcttcttgcggtgcttcagcggtttggttttgatgaaaaatttgtgcattggattttggtgattttgc 11360  T
Q  111 aatccgctcgtttatcagtattggttaatgggaaggccgttgggttcttttcatgttcgcgtggtgtttgccaaggagacccattgtcaccgcttctttt 210  Q
    ||||||||||||||||||| |||||||||||||| ||||||||||||||| | ||||||| ||||||| |||||||||||||||||||||||||||||||    
T  11361 aatccgctcgtttatcagtcttggttaatgggaaagccgttgggttctttacttgttcgcatggtgttcgccaaggagacccattgtcaccgcttctttt 11460  T
Q  211 ttgtctagctgaagaggttcttagtcgggctctttccatggctgcgactgatggacacctcattccattgtcctattgctgtggagtctctttccccact 310  Q
    |||||||| ||||||||||||||||||||| |||||||||||||||||||| ||||| ||||||||| ||||||||||  ||||||| ||||||||||||    
T  11461 ttgtctagttgaagaggttcttagtcgggcgctttccatggctgcgactgacggacaactcattccaatgtcctattgtcgtggagtatctttccccact 11560  T
Q  311 catattttatacgc 324  Q
    ||||||||||||||    
T  11561 catattttatacgc 11574  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 103; Significance: 3e-51; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 14 - 324
Target Start/End: Original strand, 19739578 - 19739888
Alignment:
Q  14 aaggcattcgatgcgttagattggaattttcttcttgcggtgcttcagcggtttagttttgatgaaaaatttgtgcattggattttggtgattttgcaat 113  Q
    ||||| |||||| | |||||||||||||| ||| ||  ||| |||| ||||||| ||||| |||||||| ||||||||||||| |||||||||||| |||    
T  19739578 aaggctttcgataccttagattggaatttccttattttggttcttcggcggtttggttttcatgaaaaaattgtgcattggatcttggtgattttgaaat 19739677  T
Q  114 ccgctcgtttatcagtattggttaatgggaaggccgttgggttcttttcatgttcgcgtggtgtttgccaaggagacccattgtcaccgcttcttttttg 213  Q
    | || ||||||||||| |||||||||||||| || |||||||| ||||| || ||| |||| ||| | |||||| |||||||||| || ||||| || ||    
T  19739678 cagcccgtttatcagtgttggttaatgggaaagctgttgggtttttttcttgctcgggtggggttcgacaaggacacccattgtcccctcttctcttctg 19739777  T
Q  214 tctagctgaagaggttcttagtcgggctctttccatggctgcgactgatggacacctcattccattgtcctattgctgtggagtctctttccccactcat 313  Q
    ||| ||||||||||||||||||||||| || ||||| ||| | |||   ||||  ||||  ||| |||| |||||  |||| |||||| | ||||||||     
T  19739778 tctggctgaagaggttcttagtcgggcactctccattgcttcaactttcggacgactcacaccaatgtcttattgtcgtggggtctctcttcccactcag 19739877  T
Q  314 attttatacgc 324  Q
    |||||||||||    
T  19739878 attttatacgc 19739888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0075 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0075
Description:

Target: scaffold0075; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 171 - 241
Target Start/End: Complemental strand, 48800 - 48730
Alignment:
Q  171 gtggtgtttgccaaggagacccattgtcaccgcttcttttttgtctagctgaagaggttcttagtcgggct 241  Q
    |||||||| | ||||| ||||| ||||| || |||||||| ||||||||||||||||| || || ||||||    
T  48800 gtggtgttcgacaaggggaccccttgtccccccttcttttctgtctagctgaagaggtgctaagccgggct 48730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 170 - 228
Target Start/End: Complemental strand, 15144264 - 15144206
Alignment:
Q  170 cgtggtgtttgccaaggagacccattgtcaccgcttcttttttgtctagctgaagaggt 228  Q
    ||||||||| | ||||| ||||| ||||| || |||||||| |||||||||||||||||    
T  15144264 cgtggtgttcgacaaggggaccccttgtccccccttcttttctgtctagctgaagaggt 15144206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 171 - 241
Target Start/End: Complemental strand, 9077 - 9007
Alignment:
Q  171 gtggtgtttgccaaggagacccattgtcaccgcttcttttttgtctagctgaagaggttcttagtcgggct 241  Q
    |||||||| | ||||| ||||| ||||| || |||||||| ||||||||||||||||| || || ||||||    
T  9077 gtggtgttcgacaaggggaccccttgtccccccttcttttctgtctagctgaagaggtgctaagccgggct 9007  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 203 - 235
Target Start/End: Complemental strand, 8636245 - 8636213
Alignment:
Q  203 cttcttttttgtctagctgaagaggttcttagt 235  Q
    |||||||||||| ||||||||||||||||||||    
T  8636245 cttcttttttgtttagctgaagaggttcttagt 8636213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University