View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15720_low_47 (Length: 213)

Name: NF15720_low_47
Description: NF15720
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15720_low_47
NF15720_low_47
[»] chr4 (2 HSPs)
chr4 (103-200)||(35902574-35902671)
chr4 (13-54)||(35902710-35902751)


Alignment Details
Target: chr4 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 103 - 200
Target Start/End: Complemental strand, 35902671 - 35902574
Alignment:
Q  103 tatgttgcatttccagattagggactcaattcttggcactctacttaaaagtttgaggaactcttaaacgtgttacgaatgactttcctgccatatat 200  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
T  35902671 tatgttgcatttccagattagggactcaattcttggcactctatttaaaagtttgaggaactcttaaacgtgttatgaatgactttcctgccatatat 35902574  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 13 - 54
Target Start/End: Complemental strand, 35902751 - 35902710
Alignment:
Q  13 aaatgaatataaaatgagactatattatgaccaaactgaatt 54  Q
    ||||||||| ||||||||||||||||||||||||||||||||    
T  35902751 aaatgaataaaaaatgagactatattatgaccaaactgaatt 35902710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University