View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15719_high_7 (Length: 379)

Name: NF15719_high_7
Description: NF15719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15719_high_7
NF15719_high_7
[»] chr2 (1 HSPs)
chr2 (34-134)||(20248673-20248773)


Alignment Details
Target: chr2 (Bit Score: 85; Significance: 2e-40; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 34 - 134
Target Start/End: Complemental strand, 20248773 - 20248673
Alignment:
Q  34 taaccctgatgacagaacaattgctttaaatgaaaacttcaatgcatatgaagttatgggtataaaaaagaaggatggtgtatccagaagaaaaggtaga 133  Q
    |||| |||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||    
T  20248773 taactctgatgacagaacaattgctttgaatgaaaacttcaatgcatctgaagttatgggtataaaaaagaaggatggtgtatccagaggaaaaggtaga 20248674  T
Q  134 c 134  Q
    |    
T  20248673 c 20248673  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University