View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15718_low_67 (Length: 206)

Name: NF15718_low_67
Description: NF15718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15718_low_67
NF15718_low_67
[»] chr4 (1 HSPs)
chr4 (17-196)||(21293984-21294165)


Alignment Details
Target: chr4 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 17 - 196
Target Start/End: Complemental strand, 21294165 - 21293984
Alignment:
Q  17 aggggaccgtacaattggtcattttctccagattaataatgaagccccataagaaactgataataataata---gtcgctaatatctaatatcataaata 113  Q
    |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||   ||||||||||||||||||||||||||    
T  21294165 aggggaccgtacaattggtcattttctccagattaata-tgaagccccataagaaactgataataataataatagtcgctaatatctaatatcataaata 21294067  T
Q  114 tagtattgtcggtacaacaaaatgatagaataagcaacatttaaggttcagtttaggctcacatctagctacagatgatgtcc 196  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  21294066 tagtattgtcggtacaacaaaatgatagaataagcaacatttaaggttcagtttaggctcacatctagctacagatgatgtcc 21293984  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University