View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15718_low_50 (Length: 268)

Name: NF15718_low_50
Description: NF15718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15718_low_50
NF15718_low_50
[»] chr5 (1 HSPs)
chr5 (18-256)||(3345936-3346176)


Alignment Details
Target: chr5 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 18 - 256
Target Start/End: Complemental strand, 3346176 - 3345936
Alignment:
Q  18 aaccacatggttaaaca---gtaagattttgttttttgg---aagactaaacaatcgttagatgataagcaccactacatgcatgttactataaaggaga 111  Q
    |||||||||||||||||   |||||||||||||||||     |||||||||||||||||||||||||||||| ||||||||    |||||||||||||||    
T  3346176 aaccacatggttaaacaattgtaagattttgtttttttttttaagactaaacaatcgttagatgataagcactactacatg----ttactataaaggaga 3346081  T
Q  112 taatgtggaaggaattaatttacaatattttttgttgccattataaaataatcattgtgggatgacgtctcttcaaagaaaatacttgatttctcaaaca 211  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  3346080 taatgtggaaggaattaatttacaatattttttgttgccattataaaataatcattgtgggatgacgtctcttcaaagaaaatacttgatttctcaaaca 3345981  T
Q  212 aatggaaaaagtaataatcaataaataaaaccaattgtgttctct 256  Q
    |||||||||||||||||||||||||||||||||||||||||||||    
T  3345980 aatggaaaaagtaataatcaataaataaaaccaattgtgttctct 3345936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University