View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15718_high_50 (Length: 222)

Name: NF15718_high_50
Description: NF15718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15718_high_50
NF15718_high_50
[»] chr7 (1 HSPs)
chr7 (145-207)||(2426663-2426725)


Alignment Details
Target: chr7 (Bit Score: 59; Significance: 4e-25; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 145 - 207
Target Start/End: Original strand, 2426663 - 2426725
Alignment:
Q  145 cacttacctaaagcatacatcttttggtaattcaagatatcaaattttctcattctttctctg 207  Q
    |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
T  2426663 cacttacctaaagcatacatcttttgataattcaagatatcaaattttctcattctttctctg 2426725  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University