View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15718_high_41 (Length: 268)

Name: NF15718_high_41
Description: NF15718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15718_high_41
NF15718_high_41
[»] chr8 (1 HSPs)
chr8 (2-252)||(9003612-9003862)


Alignment Details
Target: chr8 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 2 - 252
Target Start/End: Original strand, 9003612 - 9003862
Alignment:
Q  2 ttaggtgtcgaatatgattggtgatggtggtcaagaagaaggatgggtggtgtgtaggatattcaagaagaagaatcatctcaaaaccctagacagccct 101  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  9003612 ttaggtgtcgaatatgattggtgatggtggtcaagaagaaggatgggtggtgtgtaggatattcaagaagaagaatcatctcaaaaccctagacagccct 9003711  T
Q  102 tctggagagggaagaagaagccatcacttgtatgatacttgtgatgaaggagctttggagcaaatacttcaacaaatgggaaggggttgcaaggaagaga 201  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  9003712 tctggagagggaagaagaagccatcacttgtatgatacttgtgatgaaggagctttggagcaaatacttcaacaaatgggaaggggttgcaaggaagaga 9003811  T
Q  202 attatgaagcaaattacaataataattatggaaggtttgctaggccctttg 252  Q
    |||||||||||||||||||||||||||||||||||||||||||||| ||||    
T  9003812 attatgaagcaaattacaataataattatggaaggtttgctaggccttttg 9003862  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University