View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15717_low_9 (Length: 306)

Name: NF15717_low_9
Description: NF15717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15717_low_9
NF15717_low_9
[»] chr8 (2 HSPs)
chr8 (18-125)||(43016495-43016602)
chr8 (187-222)||(43016398-43016433)


Alignment Details
Target: chr8 (Bit Score: 108; Significance: 3e-54; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 18 - 125
Target Start/End: Complemental strand, 43016602 - 43016495
Alignment:
Q  18 aagaatatttaagaagactaaattggaatggatgatgaataatacatacctgaaaattttcattttgttggagcatgattgttgaaacatggtaagaatt 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  43016602 aagaatatttaagaagactaaattggaatggatgatgaataatacatacctgaaaattttcattttgttggagcatgattgttgaaacatggtaagaatt 43016503  T
Q  118 gtcatcaa 125  Q
    ||||||||    
T  43016502 gtcatcaa 43016495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 187 - 222
Target Start/End: Complemental strand, 43016433 - 43016398
Alignment:
Q  187 aggcctacttatatggaaagctgcgtttgcactaat 222  Q
    ||||||||||||||||||||||||||||||||||||    
T  43016433 aggcctacttatatggaaagctgcgtttgcactaat 43016398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University