View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15717_low_3 (Length: 447)

Name: NF15717_low_3
Description: NF15717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15717_low_3
NF15717_low_3
[»] chr6 (1 HSPs)
chr6 (15-117)||(21144596-21144698)


Alignment Details
Target: chr6 (Bit Score: 99; Significance: 1e-48; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 15 - 117
Target Start/End: Complemental strand, 21144698 - 21144596
Alignment:
Q  15 atgaactggtaaacttaggattttaatccaaacagttattttgctggccactaagcttggattccattccttcatctccctaaaatgagaatcccaccaa 114  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  21144698 atgaactggtaaacttaggattttaatccaaacagttcttttgctggccactaagcttggattccattccttcatctccctaaaatgagaatcccaccaa 21144599  T
Q  115 aat 117  Q
    |||    
T  21144598 aat 21144596  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University