View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15717_low_11 (Length: 282)

Name: NF15717_low_11
Description: NF15717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15717_low_11
NF15717_low_11
[»] chr2 (1 HSPs)
chr2 (64-260)||(17472641-17472838)


Alignment Details
Target: chr2 (Bit Score: 170; Significance: 3e-91; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 64 - 260
Target Start/End: Original strand, 17472641 - 17472838
Alignment:
Q  64 acttgcatttcatcattcattttgcttagatcacaaccgatagctttggaacttgcacgtacgtgcactcatgcagttgataagtgtctctttcgcatta 163  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
T  17472641 acttgcatttcatcattcattttgcttagatcacaaccgatagctttggaacttgcacgtacgtgcactcatgcagttgataagtgtctttttcgcatta 17472740  T
Q  164 gaatggatc-tcccgccgcttgttttgattatcttttaagctgtatttggtttggaagagagaaataagttggaggggtatttggtaatttcgtggtt 260  Q
    ||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||| |||||    
T  17472741 gaatggatcttcccgccgcttgttttggttatcttttaagctgtatttggtttggaagagagaaataagttggaggagtatttggtattttcctggtt 17472838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University