View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15713_low_9 (Length: 417)

Name: NF15713_low_9
Description: NF15713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15713_low_9
NF15713_low_9
[»] chr7 (4 HSPs)
chr7 (16-221)||(25527614-25527819)
chr7 (16-214)||(25535643-25535841)
chr7 (16-157)||(25514657-25514798)
chr7 (281-398)||(25527879-25527996)


Alignment Details
Target: chr7 (Bit Score: 198; Significance: 1e-108; HSPs: 4)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 16 - 221
Target Start/End: Original strand, 25527614 - 25527819
Alignment:
Q  16 atcaagagcttcgttgtgtctttttgcgcggtgcatggcaccgatgatggcgttgcaggtgaacaccgtcggacgagtcgttgctgagaacgccgactgg 115  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
T  25527614 atcaagagcttcgttgtgtctttttgcgcggtgcatggcaccgatgatggcgttgcaggtgaacaccgtcggacgattcgttgctgagaacgccgactgg 25527713  T
Q  116 cgggccatggcagaggcagcgtcgaggttgccggagcgaatcaatgacgtgacacgcgtgtggagttcttcaggaggaggctggggctccgccgttgctg 215  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
T  25527714 cgggccatggcagaggcagcgtcgaggttgccggagcgaatcaatgacgtgacacgcgtgtggagttcttcaggaggaggctgaggctccgccgttgctg 25527813  T
Q  216 cttgtt 221  Q
    ||||||    
T  25527814 cttgtt 25527819  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 131; E-Value: 8e-68
Query Start/End: Original strand, 16 - 214
Target Start/End: Original strand, 25535643 - 25535841
Alignment:
Q  16 atcaagagcttcgttgtgtctttttgcgcggtgcatggcaccgatgatggcgttgcaggtgaacaccgtcggacgagtcgttgctgagaacgccgactgg 115  Q
    |||||||||||| |||| |||||| || |||||||| ||| | ||||| || |||||||||||||| || |||||||| ||||||||||||| |||||||    
T  25535643 atcaagagcttcattgtatcttttcgcacggtgcattgcagcaatgatagcattgcaggtgaacacagttggacgagttgttgctgagaacgtcgactgg 25535742  T
Q  116 cgggccatggcagaggcagcgtcgaggttgccggagcgaatcaatgacgtgacacgcgtgtggagttcttcaggaggaggctggggctccgccgttgct 214  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||  |||| |||||||||||||||||||||||||||||||||||||||||||||    
T  25535743 cgggccatggcagaggcagcgtcgaggttgccggagcgaatcaacgatctgacgcgcgtgtggagttcttcaggaggaggctggggctccgccgttgct 25535841  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 126; E-Value: 8e-65
Query Start/End: Original strand, 16 - 157
Target Start/End: Complemental strand, 25514798 - 25514657
Alignment:
Q  16 atcaagagcttcgttgtgtctttttgcgcggtgcatggcaccgatgatggcgttgcaggtgaacaccgtcggacgagtcgttgctgagaacgccgactgg 115  Q
    ||||||||||| |||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  25514798 atcaagagcttggttgtgtctttttgcgtggagcatggcaccgatgatggcgttgcaggtgaacaccgtcggacgagtcgttgctgagaacgccgactgg 25514699  T
Q  116 cgggccatggcagaggcagcgtcgaggttgccggagcgaatc 157  Q
    |||||||||||||||||||||| |||||||||||||||||||    
T  25514698 cgggccatggcagaggcagcgttgaggttgccggagcgaatc 25514657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 106; E-Value: 6e-53
Query Start/End: Original strand, 281 - 398
Target Start/End: Original strand, 25527879 - 25527996
Alignment:
Q  281 tggcgacagagtgacattgttgagtttgaaaccctaaaatttcgtactttctaatttgaaatgaaaatgaaatgaattcttctaacatctttcttcttat 380  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
T  25527879 tggcgaaagagtgacattgttgagtttgaaaccctaaaatttcgtactttctattttgaaatgaaaatgaaatgaattcttctaacatctttcttcttat 25527978  T
Q  381 atatactacccccagcag 398  Q
    |||||||||| |||||||    
T  25527979 atatactaccaccagcag 25527996  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University