View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15712_low_24 (Length: 307)

Name: NF15712_low_24
Description: NF15712
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15712_low_24
NF15712_low_24
[»] chr8 (1 HSPs)
chr8 (235-307)||(43803071-43803144)


Alignment Details
Target: chr8 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 235 - 307
Target Start/End: Complemental strand, 43803144 - 43803071
Alignment:
Q  235 ttataaacaaaggaaacaaatagaaaa-gtgattctcattactcaattatggaaagtacaagatgtatatatac 307  Q
    |||| |||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
T  43803144 ttatgaacaaaagaaacaaatagaaaaagtgattctcattactcaattatggaaagtacaagatgtatatatac 43803071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University