View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15712_high_31 (Length: 264)

Name: NF15712_high_31
Description: NF15712
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15712_high_31
NF15712_high_31
[»] chr1 (1 HSPs)
chr1 (100-216)||(3478423-3478540)


Alignment Details
Target: chr1 (Bit Score: 66; Significance: 3e-29; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 100 - 216
Target Start/End: Original strand, 3478423 - 3478540
Alignment:
Q  100 tattatatttgatgactattaaaagttctgaatattatttatgaatttggagnnnnnnnnctacgtaga-tttgactttaataatacaaaactaacatcc 198  Q
    |||||||||||||||||||||||||||||||||||||||||  |||||||||        |||  |||| ||||||||||||||||||||| ||||||||    
T  3478423 tattatatttgatgactattaaaagttctgaatattatttagtaatttggagaaaaaaaactatttagattttgactttaataatacaaaattaacatcc 3478522  T
Q  199 tttatacaaccaaacact 216  Q
    ||||||||||||||||||    
T  3478523 tttatacaaccaaacact 3478540  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University