View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15712_high_16 (Length: 388)

Name: NF15712_high_16
Description: NF15712
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15712_high_16
NF15712_high_16
[»] scaffold0011 (3 HSPs)
scaffold0011 (64-302)||(190607-190845)
scaffold0011 (41-256)||(218867-219082)
scaffold0011 (317-350)||(190546-190579)


Alignment Details
Target: scaffold0011 (Bit Score: 215; Significance: 1e-118; HSPs: 3)
Name: scaffold0011
Description:

Target: scaffold0011; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 64 - 302
Target Start/End: Complemental strand, 190845 - 190607
Alignment:
Q  64 cattataatactttgtccaaaggatgcctttgcatcccaattgattatgatagaaaatttgagggacacactcatgataaaatatggcaagatcttgtgt 163  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  190845 cattataatactttgtccaaaggatgccattgcatcccaattgattatgatagaaaatttgagggacacactcatgataaaatatggcaagatcttgtgt 190746  T
Q  164 gtgtttctaatttatatggtacccattgcaattgccatccctatttatggtgtttggggaccgtacccagcgagacagtagaggaattgaattacgtacg 263  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||     
T  190745 gtgtttctaattcatatggtacccattgcaattgccatccctatttatggtgtttggggaccgtacccagcgagacggtagaggaattgaattgcgtaca 190646  T
Q  264 attggaatttaattcagttgacagacagcaccgttggcg 302  Q
    |||||||||||||||| ||||||||||||||||||||||    
T  190645 attggaatttaattcatttgacagacagcaccgttggcg 190607  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0011; HSP #2
Raw Score: 196; E-Value: 1e-106
Query Start/End: Original strand, 41 - 256
Target Start/End: Complemental strand, 219082 - 218867
Alignment:
Q  41 atatatatagatctgaggatggacattataatactttgtccaaaggatgcctttgcatcccaattgattatgatagaaaatttgagggacacactcatga 140  Q
    ||||| ||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
T  219082 atatacatagatctgaggaaggacattataatactttgtccaaaggatgccattgcatcccaattgattatgatagaaaatttgagggacacactcatga 218983  T
Q  141 taaaatatggcaagatcttgtgtgtgtttctaatttatatggtacccattgcaattgccatccctatttatggtgtttggggaccgtacccagcgagaca 240  Q
    ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
T  218982 taaaatatggcaagatcttgtgtgtgtttctaattcatatggtacccattgcaattgccatccctatttatggtgtttggggaccgtacccagcgagacg 218883  T
Q  241 gtagaggaattgaatt 256  Q
    ||||||||||||||||    
T  218882 gtagaggaattgaatt 218867  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0011; HSP #3
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 317 - 350
Target Start/End: Complemental strand, 190579 - 190546
Alignment:
Q  317 tctcattctaccttgtttgaaggagcaatgatga 350  Q
    ||||||||||||||||||||||||||||||||||    
T  190579 tctcattctaccttgtttgaaggagcaatgatga 190546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University