View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1570_low_16 (Length: 232)

Name: NF1570_low_16
Description: NF1570
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1570_low_16
NF1570_low_16
[»] chr3 (1 HSPs)
chr3 (12-224)||(50016837-50017049)


Alignment Details
Target: chr3 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 12 - 224
Target Start/End: Complemental strand, 50017049 - 50016837
Alignment:
Q  12 tggtgtactgtctacaagttttagtgtatttttagttatacaatacaatagacgtgttgaaattaagatgagccacctttggcagcaaacatccacttct 111  Q
    ||||| |||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||    
T  50017049 tggtggactgtctataggttttagtgtatttttagttatacaatacaatagacgtgttgaaattaagatgagccacctttggtagcaaacatccactcct 50016950  T
Q  112 gttacaatcatattattacttcttgttagcaatcataccctgaaattgtttgccagtatttaggctacaatctacaaaagttcccataacatcgttccaa 211  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  50016949 gttacaatcatattattacttcttgttagcaatcataccctgaaattgtttgccagtatttaggctacaatctacaaaagttcccataacatcgttccaa 50016850  T
Q  212 tggtagtttcaac 224  Q
    |||||| ||||||    
T  50016849 tggtagattcaac 50016837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University