View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15707_high_21 (Length: 204)

Name: NF15707_high_21
Description: NF15707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15707_high_21
NF15707_high_21
[»] chr1 (1 HSPs)
chr1 (7-191)||(48276583-48276767)


Alignment Details
Target: chr1 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 7 - 191
Target Start/End: Complemental strand, 48276767 - 48276583
Alignment:
Q  7 atattgatgatgaattgaactactatcatgatccaaacctaacaactgatgagggagtgcagtcaacgagccgccgttacctctcagcacttgttcaaca 106  Q
    ||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||| ||||||| |||||||||||||||||||||||||||||||    
T  48276767 atattgatgatgaattgaactactatcatgatccacacctaacaactgatcagggagtgccgtcaacgcgccgccgttacctctcagcacttgttcaaca 48276668  T
Q  107 ccaagttgacagaattgccactttccagtccataacagcccaactgctccatttactggatttatagttctcccaacagcttcat 191  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  48276667 ccaagttgacagaattgccactttccagtccataacagcccaactgctccatttactggatttatagttctcccaacagcttcat 48276583  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University