View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15705_low_36 (Length: 240)

Name: NF15705_low_36
Description: NF15705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15705_low_36
NF15705_low_36
[»] chr1 (1 HSPs)
chr1 (16-222)||(43885359-43885565)


Alignment Details
Target: chr1 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 16 - 222
Target Start/End: Complemental strand, 43885565 - 43885359
Alignment:
Q  16 atgaacatacgaggatcaaacatttatgaatgtttttgaatgttaccatattattggtaggaaaattacattgctgcgggagagacatagatgtagcttt 115  Q
    |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
T  43885565 atgaacatgcgaggatcaaacatttatgaatgtttttgaatgttaccatattattggtaggaaaatgacattgctgcgggagagacatagatgtagcttt 43885466  T
Q  116 tactctttcaacaagttttttattttctcaccatgcaagattgggagatcgaacacttaaccatttattcaaaggactcacttacatctttatcatttag 215  Q
    |||||||| |||||| |||||||||||||||| ||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
T  43885465 tactctttaaacaagatttttattttctcaccgtgcaagattaggagatggaacacttaaccatttattcaaaggactcacttacatctttatcatttag 43885366  T
Q  216 atcttgt 222  Q
    |||||||    
T  43885365 atcttgt 43885359  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University