View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15700_low_6 (Length: 248)

Name: NF15700_low_6
Description: NF15700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15700_low_6
NF15700_low_6
[»] chr6 (1 HSPs)
chr6 (17-81)||(3263978-3264042)
[»] chr4 (1 HSPs)
chr4 (38-138)||(27736249-27736348)


Alignment Details
Target: chr6 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 17 - 81
Target Start/End: Original strand, 3263978 - 3264042
Alignment:
Q  17 aatatcgataaaacaagccaaattagtttgaaaaataggactaccttacacatgagctaaactat 81  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  3263978 aatatcgataaaacaagccaaattagtttgaaaaataggactaccttacacatgagctaaactat 3264042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 38 - 138
Target Start/End: Complemental strand, 27736348 - 27736249
Alignment:
Q  38 attagtttgaaaaataggactaccttacacatgagctaaactattgcaaatatcactaaaacattgcaaatgaattaattcatcgaataagtaattgtat 137  Q
    ||||||| |||| ||||| ||| ||| |||| | || ||||||||||||| |||||||||| | ||||||| |||||||| ||| || |||| ||| |||    
T  27736348 attagttcgaaatatagggctatctttcacacgtgccaaactattgcaaagatcactaaaa-aatgcaaattaattaattaatcaaacaagtgattatat 27736250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University