View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1569_low_23 (Length: 237)

Name: NF1569_low_23
Description: NF1569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1569_low_23
NF1569_low_23
[»] chr2 (2 HSPs)
chr2 (18-127)||(16479765-16479874)
chr2 (188-237)||(16479652-16479701)


Alignment Details
Target: chr2 (Bit Score: 102; Significance: 9e-51; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 18 - 127
Target Start/End: Complemental strand, 16479874 - 16479765
Alignment:
Q  18 atgggtgctcataatccatttggtgatcctttacctgttgctagttatcctcataattctatgccccagcaaggaaattacaatttaatgtagagttttc 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||    
T  16479874 atgggtgctcataatccatttggtgatcctttacctgttgctagttaccctcataattctatgccgcagcaaggaaattacaatttaatgtagagttttc 16479775  T
Q  118 cttttacttg 127  Q
    ||||||||||    
T  16479774 cttttacttg 16479765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 188 - 237
Target Start/End: Complemental strand, 16479701 - 16479652
Alignment:
Q  188 agttatcaataatttgttttagataaacttttcattgcctagatatatcc 237  Q
    ||||||||||||||| | ||||||||||||||| ||||||||||||||||    
T  16479701 agttatcaataatttatattagataaacttttccttgcctagatatatcc 16479652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University