View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15694_high_24 (Length: 239)

Name: NF15694_high_24
Description: NF15694
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15694_high_24
NF15694_high_24
[»] chr5 (1 HSPs)
chr5 (35-184)||(33113061-33113210)


Alignment Details
Target: chr5 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 35 - 184
Target Start/End: Original strand, 33113061 - 33113210
Alignment:
Q  35 ggaattaatttttaatagtcggtttagtaaaaatattgatcatctttatcttcttttcttgtttatcggtgatcatgggaagaccgttacggaaaatttt 134  Q
    |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
T  33113061 ggaattaaattttaatagtcggtttagtaaaaatattgatcatctttatcttcttttcttgtttattggtgatcatgggaagaccgttacggaaaatttt 33113160  T
Q  135 aattaaaaagattaacatgcgaagattctcttttatttattggataatac 184  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||    
T  33113161 aattaacaagattaacatgcgaagattctcttttatttattggataatac 33113210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University