View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15691_low_18 (Length: 204)

Name: NF15691_low_18
Description: NF15691
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15691_low_18
NF15691_low_18
[»] chr2 (1 HSPs)
chr2 (18-128)||(26716859-26716970)


Alignment Details
Target: chr2 (Bit Score: 104; Significance: 5e-52; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 18 - 128
Target Start/End: Original strand, 26716859 - 26716970
Alignment:
Q  18 actaatatcaaatttgatg-cattgttatcagttggaaaataactaaatataaaactgtatgataaatagaaattatataaatttcatgaatagcccatg 116  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  26716859 actaatatcaaatttgatgacattgttatcagttggaaaataactaaatataaaactgtatgataaatagaaattatataaatttcatgaatagcccatg 26716958  T
Q  117 tacaatcctttc 128  Q
    ||||||||||||    
T  26716959 tacaatcctttc 26716970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University