View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15691_low_11 (Length: 240)

Name: NF15691_low_11
Description: NF15691
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15691_low_11
NF15691_low_11
[»] chr2 (1 HSPs)
chr2 (48-237)||(1001026-1001211)


Alignment Details
Target: chr2 (Bit Score: 109; Significance: 6e-55; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 48 - 237
Target Start/End: Complemental strand, 1001211 - 1001026
Alignment:
Q  48 tttcatatttttctttgcaacttataggaactcaactatcatactgtaaaagctttcaataccttttgttatagtaatatggctagttctccaaacaact 147  Q
    |||||||||||||||||||||||||  ||| |||||||||||| | |||||||||| |||||||||||||||||||||||||||||||||||||||||||    
T  1001211 tttcatatttttctttgcaacttatcagaagtcaactatcatattataaaagctttaaataccttttgttatagtaatatggctagttctccaaacaact 1001112  T
Q  148 aacataatgatataagtttccctgnnnnnnntaatgatataagaataaaatatatagatggcaacttgagtaaatgtaacaggaactgaa 237  Q
    |||||||||||||||||||||||         ||| | |||||||||||||||||| ||||||| ||||||||||||||||  |||||||    
T  1001111 aacataatgatataagtttccct----aaaaaaataaaataagaataaaatatataaatggcaatttgagtaaatgtaacaaaaactgaa 1001026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University