View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15688_low_10 (Length: 208)

Name: NF15688_low_10
Description: NF15688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15688_low_10
NF15688_low_10
[»] chr5 (1 HSPs)
chr5 (16-117)||(10360147-10360248)


Alignment Details
Target: chr5 (Bit Score: 90; Significance: 1e-43; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 16 - 117
Target Start/End: Complemental strand, 10360248 - 10360147
Alignment:
Q  16 ttttcctctagtaatttcctcctttccaaattcaatttggacattgccctaaacaagagttggcttcttcttcctgttttgtcgtttgtaggatcagcat 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||| |||    
T  10360248 ttttcctctagtaatttcctcctttccaaattcaatttggacattgccctaaacaagagtttgcttcttcttcctgttttgtcgtttttaggatcaacat 10360149  T
Q  116 tg 117  Q
    ||    
T  10360148 tg 10360147  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University