View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1568-INSERTION-2 (Length: 314)

Name: NF1568-INSERTION-2
Description: NF1568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1568-INSERTION-2
NF1568-INSERTION-2
[»] chr5 (1 HSPs)
chr5 (8-314)||(23739902-23740208)


Alignment Details
Target: chr5 (Bit Score: 282; Significance: 1e-158; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 8 - 314
Target Start/End: Complemental strand, 23740208 - 23739902
Alignment:
Q  8 gtattggtctaacctacccaaaagtggattgcacagtcctagataattggaactaaataaaaatttgataagtttttccagacttaggattatttacgtt 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  23740208 gtattggtctaacctacccaaaagtggattgcacagtcctagataattggaactaaataaaaatttgataagtttttccagacttaggattatttacgtt 23740109  T
Q  108 cgacnnnnnnnatccaattatgataattgtctttcctgatgtaagaagcagatcgaaagaatcttctaggagcactctttaaacccatctgataaggccc 207  Q
    ||||       ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
T  23740108 cgactttttttatccaattatgataattgtctttcctgatgtaagaagcagatcgaaagaatcttctaggagcactctttaaacccatctcataaggccc 23740009  T
Q  208 ctctaaaacaagcctaggtttgcaattaggatatccagggaaaagagcgtttacctttttggtgtttatggaagagtctgggaaagggactaagaacaca 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  23740008 ctctaaaacaagcctaggtttgcaattaggatatccagggaaaagagcgtttacctttttggtgtttatggaagagtctgggaaagggactaagaacaca 23739909  T
Q  308 tgcatat 314  Q
    |||||||    
T  23739908 tgcatat 23739902  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University