View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1566_low_20 (Length: 305)

Name: NF1566_low_20
Description: NF1566
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1566_low_20
NF1566_low_20
[»] chr1 (1 HSPs)
chr1 (18-295)||(8457209-8457486)
[»] chr8 (1 HSPs)
chr8 (18-99)||(6827844-6827925)
[»] chr3 (1 HSPs)
chr3 (18-99)||(27964487-27964568)
[»] chr6 (1 HSPs)
chr6 (18-60)||(9822258-9822300)


Alignment Details
Target: chr1 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 18 - 295
Target Start/End: Complemental strand, 8457486 - 8457209
Alignment:
Q  18 gatattgggaaacccgtggaaaatggccccagtgtttcgattaccctgaaataaacaacacaaagatacaacaggaggaacatgggattcaaattcgaat 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  8457486 gatattgggaaacccgtggaaaatggccccagtgtttcgattaccctgaaataaacaacacaaagatacaacaggaggaacatgggattcaaattcgaat 8457387  T
Q  118 aaaatgaaaatatatttgaatgtatcatatatgttaccagtccaccagtagatgatgttacagcacgttcatcccacggtaatggaattccatcaaaacg 217  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  8457386 aaaatgaaaatatatttggatgtatcatatatgttaccagtccaccagtagatgatgttacagcacgttcatcccacggtaatggaattccatcaaaacg 8457287  T
Q  218 attatacatccctccatgtccttgggtggtaccaacacgatgattgataactatatcagccattgctctgactctctg 295  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
T  8457286 attatacatccctccatgtccttgggtggtaccaacacgatgattgataactatatcagccattgctctgactttctg 8457209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 18 - 99
Target Start/End: Original strand, 6827844 - 6827925
Alignment:
Q  18 gatattgggaaacccgtggaaaatggccccagtgtttcgattaccctgaaataaacaacacaaagatacaacaggaggaaca 99  Q
    ||||||||||||||||||||||||||||||||||||||||||| || ||||| |||||| |||||||||| || ||||||||    
T  6827844 gatattgggaaacccgtggaaaatggccccagtgtttcgattaaccagaaatgaacaacgcaaagatacagcaagaggaaca 6827925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 18 - 99
Target Start/End: Original strand, 27964487 - 27964568
Alignment:
Q  18 gatattgggaaacccgtggaaaatggccccagtgtttcgattaccctgaaataaacaacacaaagatacaacaggaggaaca 99  Q
    ||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||| |||||||| | || ||||||||    
T  27964487 gatattgggaaacccgtggaaaatggccccagtgtttcgattaacctgaaatgaacaacgcaaagatatagcaagaggaaca 27964568  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 18 - 60
Target Start/End: Complemental strand, 9822300 - 9822258
Alignment:
Q  18 gatattgggaaacccgtggaaaatggccccagtgtttcgatta 60  Q
    ||||| |||||||||||||||||||||||||||||||||||||    
T  9822300 gatatggggaaacccgtggaaaatggccccagtgtttcgatta 9822258  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University