View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15664_low_28 (Length: 227)

Name: NF15664_low_28
Description: NF15664
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15664_low_28
NF15664_low_28
[»] chr2 (1 HSPs)
chr2 (35-227)||(17145019-17145211)


Alignment Details
Target: chr2 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 35 - 227
Target Start/End: Complemental strand, 17145211 - 17145019
Alignment:
Q  35 agaagggtcaagatgaatagtggaaaaatggggacattaagcttgtttgtactactacttgaagtaaaagtttctccaaatatttatttatctcttcatc 134  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||     
T  17145211 agaagggtcaagatgaatagtggaaaaatggggacattaagcttgtttgtactactacttaaagtaaaagtttctccaaatatttatttatctcttcatt 17145112  T
Q  135 tatgagtgtacttgtctttcctttaattaatctctttgataatctttaaagattatatctcgtactcggattccgtgcactaaaaatatcacg 227  Q
    ||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||| ||||| |||  |||||||||||||||||||    
T  17145111 tatgagtgtacttgtctttcctttaattaatctctttcataatctttaaagattctatctcgcactcgaattatgtgcactaaaaatatcacg 17145019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University