View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1565_low_28 (Length: 238)

Name: NF1565_low_28
Description: NF1565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1565_low_28
NF1565_low_28
[»] chr1 (2 HSPs)
chr1 (29-234)||(14100507-14100712)
chr1 (128-177)||(14113272-14113322)


Alignment Details
Target: chr1 (Bit Score: 150; Significance: 2e-79; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 29 - 234
Target Start/End: Complemental strand, 14100712 - 14100507
Alignment:
Q  29 ataaaatgttgtgtactagtacacttgcccttaacataagatagtaggaatgtgcactgcactctcatgttttgcactttattaacacgagtacatattt 128  Q
    ||||||||||||||||||||| ||  || || ||| | ||||||||| ||||||||||||||| ||||||||||||||| |||||||| |||||||||||    
T  14100712 ataaaatgttgtgtactagtagaccggcactcaacgtcagatagtagaaatgtgcactgcactttcatgttttgcacttcattaacactagtacatattt 14100613  T
Q  129 ataaccactttgcctctctccacatgccaaagttaacgatgtgggacttccttcaactatttgttttaaaactcaattataatgcaggcatcagaatgtg 228  Q
    ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
T  14100612 ataaccactttgcctctctccacataccaaagttaacgatgtgggacttccttcaactatttgttttaaaactcaattataatgtaggcatcagaatgtg 14100513  T
Q  229 gggctt 234  Q
    | ||||    
T  14100512 gagctt 14100507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 128 - 177
Target Start/End: Complemental strand, 14113322 - 14113272
Alignment:
Q  128 tataaccactttgcctctctcc-acatgccaaagttaacgatgtgggactt 177  Q
    |||| ||||||||||||||||  ||||||||||||||||||||||||||||    
T  14113322 tatagccactttgcctctctcttacatgccaaagttaacgatgtgggactt 14113272  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University