View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15659_low_60 (Length: 239)

Name: NF15659_low_60
Description: NF15659
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15659_low_60
NF15659_low_60
[»] chr6 (1 HSPs)
chr6 (110-228)||(34382041-34382159)


Alignment Details
Target: chr6 (Bit Score: 107; Significance: 9e-54; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 110 - 228
Target Start/End: Original strand, 34382041 - 34382159
Alignment:
Q  110 tgaatacatggaccctgagggtggctggatggtaccatccgtggccgcggttgatgttggtccaatgttgaatttttggtggttactggtttgtgcaaag 209  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
T  34382041 tgaatacatggaccctgagggtggctggatggtactatccgtggccgcggttgatgttggtccaatgttgaatttttggtggtaactggtttgtgcaaag 34382140  T
Q  210 aaggagattggtgatgatg 228  Q
    |||||||||| ||||||||    
T  34382141 aaggagattgatgatgatg 34382159  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University