View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15659_low_25 (Length: 382)

Name: NF15659_low_25
Description: NF15659
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15659_low_25
NF15659_low_25
[»] chr8 (1 HSPs)
chr8 (233-358)||(1232100-1232228)
[»] chr2 (1 HSPs)
chr2 (4-67)||(7954980-7955043)


Alignment Details
Target: chr8 (Bit Score: 91; Significance: 5e-44; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 91; E-Value: 5e-44
Query Start/End: Original strand, 233 - 358
Target Start/End: Original strand, 1232100 - 1232228
Alignment:
Q  233 aacaaattgtagaaaatggtgaaaaagggtaacgaagaacaattgatttaatggtgaaaaatctctctcacctttat---ttgttgatgatgaggaagaa 329  Q
    ||||||||||||||||||||||||||||||||||||||||| |  ||| ||||||||||||||||||||||||||||   ||||||||| ||||||||||    
T  1232100 aacaaattgtagaaaatggtgaaaaagggtaacgaagaacagtgaattcaatggtgaaaaatctctctcacctttatttgttgttgatggtgaggaagaa 1232199  T
Q  330 acaagattgatttgtgttaatttgaacca 358  Q
    ||||||||| |||||||||||||||||||    
T  1232200 acaagattggtttgtgttaatttgaacca 1232228  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 4 - 67
Target Start/End: Complemental strand, 7955043 - 7954980
Alignment:
Q  4 ctgtgtatgtggtgttgttctgttgaggtcgcaggaggagggtggtggatggtggagagaacgg 67  Q
    ||||||||||||||||||||||| || |||| ||||||||||||||||| ||| ||||| ||||    
T  7955043 ctgtgtatgtggtgttgttctgtcgatgtcggaggaggagggtggtggacggtagagagtacgg 7954980  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University