View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15655_low_44 (Length: 260)

Name: NF15655_low_44
Description: NF15655
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15655_low_44
NF15655_low_44
[»] chr5 (1 HSPs)
chr5 (1-239)||(13748040-13748278)


Alignment Details
Target: chr5 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 13748278 - 13748040
Alignment:
Q  1 aagacggggaataatcttggcgttgatcacaaagagcaggaaacaacaccagatgatgaaccggattggcggaaaatgtttctggatggaatgcaggata 100  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  13748278 aagacggggaataatcttggagttgatcacaaagagcaggaaacaacaccagatgatgaaccggattggcggaaaatgtttctggatggaatgcaggata 13748179  T
Q  101 gagaaaaagcacttctaaccgagtacactaatactcttcggaattacaaagatgttaagaagaggctcgccgaaatagaggacaaaaatcaagacaaaac 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  13748178 gagaaaaagcacttctaaccgagtacactaatactcttcggaattacaaagatgttaagaagaggctcgccgaaatagaggacaaaaatcaagacaaaac 13748079  T
Q  201 cttggattcttgtttgcaattgcagttaaatgaactgaa 239  Q
    |||||||||||||||||||||||||||||||||||||||    
T  13748078 cttggattcttgtttgcaattgcagttaaatgaactgaa 13748040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University