View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15655_high_29 (Length: 333)

Name: NF15655_high_29
Description: NF15655
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15655_high_29
NF15655_high_29
[»] chr1 (1 HSPs)
chr1 (23-171)||(40679636-40679784)


Alignment Details
Target: chr1 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 23 - 171
Target Start/End: Complemental strand, 40679784 - 40679636
Alignment:
Q  23 cccttttaaaacctgatatccgatcaaatgattgattaatttgagaagatcaatccgataattcattagcggagagcccgttcaaaattaatatagataa 122  Q
    |||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||| |||||||||||||||||||||||    
T  40679784 cccttttaaaaccttatatccgatcaaatgattgattaatttgaggagatcaatccgataatccattagcggagagtccgttcaaaattaatatagataa 40679685  T
Q  123 gactaaagaaattggcataaagagaatttgaacataggctcttagtaga 171  Q
    ||||||||||||| ||||||||||||||||||||||| |||||||||||    
T  40679684 gactaaagaaattagcataaagagaatttgaacatagtctcttagtaga 40679636  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University