View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15644_low_29 (Length: 254)

Name: NF15644_low_29
Description: NF15644
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15644_low_29
NF15644_low_29
[»] chr3 (1 HSPs)
chr3 (1-232)||(45467140-45467371)


Alignment Details
Target: chr3 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 232
Target Start/End: Original strand, 45467140 - 45467371
Alignment:
Q  1 ttgattttttggttgatattgttccgagagatgagattaaagatgaaggtgctgctgctattgttggtgctgctgctagtggtgttccttattattatcc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  45467140 ttgattttttggttgatattgttccgagagatgagattaaagatgaaggtgctgctgctattgttggtgctgctgctagtggtgttccttattattatcc 45467239  T
Q  101 tcctatgggacaacctgctggaatgatgattggtcgtccggctgttgatccggctaccggtgtttatgttcagccgccttctcaggcttggcagtctgtt 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
T  45467240 tcctatgggacaacctgctggaatgatgattggtcgtccggctgttgatcccgctaccggtgtttatgttcagccgccttctcaggcttggcagtctgtt 45467339  T
Q  201 tggcagacgggcgcggatgatggttcttatgc 232  Q
    ||||||||||||||||||||||||||||||||    
T  45467340 tggcagacgggcgcggatgatggttcttatgc 45467371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University