View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15643_low_8 (Length: 219)

Name: NF15643_low_8
Description: NF15643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15643_low_8
NF15643_low_8
[»] chr8 (1 HSPs)
chr8 (32-133)||(30973621-30973722)


Alignment Details
Target: chr8 (Bit Score: 94; Significance: 5e-46; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 32 - 133
Target Start/End: Original strand, 30973621 - 30973722
Alignment:
Q  32 ctctaaacaaatgatgttagctttgaagaagcataaggttgtttcaacatatactgtaagcatagcttttaaggagaattttggatggacaagttaatta 131  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
T  30973621 ctctaaacaaatgatgttagctgtgaagaagcataaggttgtttcaacatatactgtaagcatagcttttaaggataattttggatggacaagttaatta 30973720  T
Q  132 ag 133  Q
    ||    
T  30973721 ag 30973722  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University