View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15642_high_46 (Length: 222)

Name: NF15642_high_46
Description: NF15642
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15642_high_46
NF15642_high_46
[»] chr5 (1 HSPs)
chr5 (24-222)||(6970764-6970962)


Alignment Details
Target: chr5 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 24 - 222
Target Start/End: Original strand, 6970764 - 6970962
Alignment:
Q  24 aatatttggaaaatactggatcaaaatgggataaaaaagtgcagggcaattagcttcattgaaattgatggctgttgttatcaatttatggtggatgata 123  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  6970764 aatatttggaaaatactggatcaaaatgggataaaaaagtgcagggcaattagcttcattgaaattgatggctgttgttatcaatttatggtggatgata 6970863  T
Q  124 aaacacatggagcttcaacaagtatatactctatgctgggtcaattaatggatcatctaaagtctgcggggtatccatgtaaacatttggatgtagagg 222  Q
    ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  6970864 aaagacatggagcttcaacaagtatatactctatgctgggtcaattaatggatcatctaaagtctgcggggtatccatgtaaacatttggatgtagagg 6970962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University