View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1563_low_23 (Length: 235)

Name: NF1563_low_23
Description: NF1563
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1563_low_23
NF1563_low_23
[»] chr7 (1 HSPs)
chr7 (1-221)||(49082423-49082663)


Alignment Details
Target: chr7 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 49082663 - 49082423
Alignment:
Q  1 tgaatcttgagaagacatcactgcaaattacatttacatacatgatgtaatgaggaaacatgaagaaggaagttatttaattagttcagacataacata- 99  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
T  49082663 tgaatcttgagaagacatcactgcaaattacatttacatacatgatgtaatgaggaaacatgaagaaggaagttatttaattagttcagacataacataa 49082564  T
Q  100 -------------------cttatgagaggaatgtttttgcaatagtgatggtccatgatttgggtaagtaatgaaaaaccagagattgatggtagatcg 180  Q
                       ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
T  49082563 cataacataacataacatacttatgagaggaatgtttttgcaattgtgatggtccatgatttgggtaagtaatgaaaaaccagagattgatgggagatcg 49082464  T
Q  181 acttctgttaatacgagatctatgtcaagtgatttattctt 221  Q
    |||||||||||||||||||||||||||||||||||||||||    
T  49082463 acttctgttaatacgagatctatgtcaagtgatttattctt 49082423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University